April 11, 2021

Mycobacterium avium subsp. paratuberculosis an infection utilizing host biomarker-based ELISAs significantly

A reference measurement of circulating ATPase inhibitory issue 1 (IF1) in people by LC-MS/MS: Comparability with standard ELISA

ATPase inhibitory issue 1 (IF1) is a 9.5 kDa protein that binds to mitochondrial and plasma membrane ATP synthase and selectively inhibits ATP hydrolysis. Lately, IF1 was recognized in systemic circulation in people. IF1 appeared as an impartial determinant of HDL-cholesterol with decrease ranges in coronary coronary heart illness (CHD) sufferers. Furthermore, IF1 was additionally discovered to negatively affiliate with mortality in these sufferers, supporting the notion that circulating IF1 could possibly be a promising biomarker of heart problems. Nonetheless, in earlier research, IF1 was quantified by a non-standardized aggressive enzyme-linked immunosorbent assay (ELISA). 

  • Herein, we’ve validated a liquid chromatography-tandem mass spectrometry methodology (LC-MS/MS) enabling the correct quantification of IF1 in human plasma.
  • Plasma IF1 was trypsin-digested by way of an optimized process earlier than LC-MS/MS evaluation. The tactic was efficiently validated over four impartial experiments into the vary of 100-1500 ng/mL. Intra- and inter-assay variation coefficients had by no means exceeded 14.2% and accuracy ranged between 95% and 102% for the chosen EAGGAFGK peptide marker.
  • Subsequently, the outcomes of the LC-MS/MS methodology have been in contrast with these obtained utilizing ELISA in 204 people from the GENES research.
  • We discovered that IF1 plasma ranges obtained utilizing each strategies have been strongly correlated (r = 0.89, p < 0.0001), whereas the Bland-Altman plot didn’t point out any main statistically important variations. To clinically validate LC-MS/MS, we confirmed the constructive correlation between IF1 plasma ranges and HDL-cholesterol (r = 0.38, p < 0.0001).
  • Apart from, we discovered decrease IF1 plasma ranges in CHD sufferers in comparison with controls (431 ± 132 ng/mL and 555 ± 173 ng/mL, respectively; p < 0.0001). Therefore, it may be concluded that the introduced LC-MS/MS analytical methodology offers a extremely particular technique for IF1 quantification in human plasma and could possibly be proposed as a reference methodology.

Anti-VN1R5 (aa347-356) antibody

STJ72406 100 µg
EUR 260

Anti-VN1R5 (aa109-119) antibody

STJ72407 100 µg
EUR 260

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Polyclonal VN1R5 Antibody

APR13971G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VN1R5 . This antibody is tested and proven to work in the following applications:

VN1R5 Antibody (HRP)

20-abx308444
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VN1R5 Antibody (FITC)

20-abx308445
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VN1R5 Antibody (Biotin)

20-abx308446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VN1R5 Polyclonal Antibody

A65978 100 µg
EUR 570.55
Description: The best epigenetics products

VN1R5 siRNA

20-abx939465
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VN1R5 Antibody, HRP conjugated

1-CSB-PA801813LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VN1R5 Antibody, FITC conjugated

1-CSB-PA801813LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VN1R5 Antibody, Biotin conjugated

1-CSB-PA801813LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VN1R5 cloning plasmid

CSB-CL801813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1074
  • Sequence: atgttgaaattggttattattgagaacatggcagaaattatgctattctcattagatctcttgcttttctccacagatatcctttgctttaattttccttctaagatgatcaaacttcctggttttattaccatacaaatcttcttttatccacaagccagctttggaatttcag
  • Show more
Description: A cloning plasmid for the VN1R5 gene.

VN1R5 Polyclonal Antibody, HRP Conjugated

A65979 100 µg
EUR 570.55
Description: kits suitable for this type of research

VN1R5 Polyclonal Antibody, FITC Conjugated

A65980 100 µg
EUR 570.55
Description: fast delivery possible

VN1R5 Polyclonal Antibody, Biotin Conjugated

A65981 100 µg
EUR 570.55
Description: reagents widely cited

Human VN1R5 shRNA Plasmid

20-abx967189
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VN1R5 Recombinant Protein (Human)

RP044776 100 ug Ask for price

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

VN1R5 ORF Vector (Human) (pORF)

ORF014926 1.0 ug DNA
EUR 354

Polyclonal VN1R5 (aa109-119) Antibody (internal region)

APR13969G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VN1R5 (aa109-119) (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal VN1R5 (aa347-356) Antibody (internal region)

APR13970G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VN1R5 (aa347-356) (internal region). This antibody is tested and proven to work in the following applications:

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

abx030146-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

abx030146-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

20-abx015491
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

20-abx322836
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

abx433448-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

abx433449-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

20-abx302011
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VN1R5 sgRNA CRISPR Lentivector set (Human)

K2613501 3 x 1.0 ug
EUR 339

VN1R5 sgRNA CRISPR Lentivector (Human) (Target 1)

K2613502 1.0 ug DNA
EUR 154

VN1R5 sgRNA CRISPR Lentivector (Human) (Target 2)

K2613503 1.0 ug DNA
EUR 154

VN1R5 sgRNA CRISPR Lentivector (Human) (Target 3)

K2613504 1.0 ug DNA
EUR 154

VN1R5 Protein Vector (Human) (pPB-C-His)

PV059701 500 ng
EUR 481

VN1R5 Protein Vector (Human) (pPB-N-His)

PV059702 500 ng
EUR 481

VN1R5 Protein Vector (Human) (pPM-C-HA)

PV059703 500 ng
EUR 481

VN1R5 Protein Vector (Human) (pPM-C-His)

PV059704 500 ng
EUR 481

VN1R5 3'UTR GFP Stable Cell Line

TU078141 1.0 ml
EUR 2333

VN1R5 3'UTR Luciferase Stable Cell Line

TU028141 1.0 ml
EUR 2333

Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit

GA-E0006HM-48T 48T
EUR 289

Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit

GA-E0006HM-96T 96T
EUR 466

Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit

QY-E02371 96T
EUR 394

Human Vomeronasal type- 1 receptor 5, VN1R5 ELISA KIT

ELI-51400h 96 Tests
EUR 824

VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2613505 3 x 1.0 ug
EUR 376

VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2613506 1.0 ug DNA
EUR 167

VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2613507 1.0 ug DNA
EUR 167

VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2613508 1.0 ug DNA
EUR 167

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-HAMA Antibody

E61I006 1mg
EUR 349

anti- ASH2L antibody

FNab00637 100µg
EUR 505.25
  • Immunogen: ash2(absent, small, or homeotic)-like(Drosophila)
  • Uniprot ID: Q9UBL3
  • Gene ID: 9070
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ASH2L

anti- ASIC2 antibody

FNab00638 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 1, neuronal
  • Uniprot ID: Q16515
  • Gene ID: 40
  • Research Area: Neuroscience
Description: Antibody raised against ASIC2

anti- ASIC4 antibody

FNab00639 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 4, pituitary
  • Uniprot ID: Q96FT7
  • Gene ID: 55515
  • Research Area: Neuroscience
Description: Antibody raised against ASIC4

anti- ASK1 antibody

FNab00640 100µg
EUR 505.25
  • Recommended dilution: WB: 1:100-1:1000
  • Immunogen: mitogen-activated protein kinase kinase kinase 5
  • Uniprot ID: Q99683
  • Gene ID: 4217
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ASK1

anti- ASL antibody

FNab00641 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:500
  • Immunogen: argininosuccinate lyase
  • Uniprot ID: P04424
  • Gene ID: 435
  • Research Area: Metabolism
Description: Antibody raised against ASL

Detection of latent types of Mycobacterium avium subsp. paratuberculosis an infection utilizing host biomarker-based ELISAs significantly improves paratuberculosis diagnostic sensitivity

Bovine paratuberculosis (PTB) is a power granulomatous enteritis, brought on by Mycobacterium avium subsp. paratuberculosis (MAP), accountable for necessary financial losses within the dairy trade. Present diagnostic strategies have low sensitivities for detection of latent types of MAP an infection, outlined by focal granulomatous lesions and scarce humoral response or MAP presence. In distinction, patent infections correspond to multifocal and diffuse sorts of enteritis the place there’s elevated antibody manufacturing, and substantial mycobacterial load.

Our earlier RNA-Seq evaluation allowed the number of 5 candidate biomarkers overexpressed in peripheral blood of MAP contaminated Holstein cows with focal (ABCA13 and MMP8) and diffuse (FAM84A, SPARC and DES) lesions vs. management animals with no detectable PTB-associated lesions in gut and regional lymph nodes. The goal of the present research was to evaluate the PTB diagnostic potential of business ELISAs designed for the particular detection of those biomarkers.

The flexibility of those ELISAs to establish animals with latent and/or patent types of MAP an infection was investigated utilizing serum from naturally contaminated cattle (n = 88) and non-infected management animals (n = 67). ROC evaluation revealed that the ABCA13-based ELISA confirmed the very best diagnostic accuracy for the detection of contaminated animals with focal lesions (AUC 0.837, sensitivity 79.25% and specificity 88.06%) and with any kind of histological lesion (AUC 0.793, sensitivity 69.41% and specificity 86.57%) enhancing on the diagnostic efficiency of the favored IDEXX ELISA and different standard diagnostic strategies.

SPARC and MMP8 confirmed the very best diagnostic accuracy for the detection of animals with multifocal (AUC 0.852) and diffuse lesions (AUC 0.831), respectively. In conclusion, our outcomes recommend that quantification of ABCA13, SPARC and MMP8 by ELISA has the potential for implementation as a diagnostic software to reliably establish MAP an infection, significantly enhancing early detection of MAP latent infections when antibody responses and fecal shedding are undetectable utilizing standard diagnostic strategies.

 

Anti-VN1R5 (aa347-356) antibody

STJ72406 100 µg
EUR 260

Anti-VN1R5 (aa109-119) antibody

STJ72407 100 µg
EUR 260

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Polyclonal VN1R5 Antibody

APR13971G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VN1R5 . This antibody is tested and proven to work in the following applications:

VN1R5 Antibody (HRP)

20-abx308444
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VN1R5 Antibody (FITC)

20-abx308445
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VN1R5 Antibody (Biotin)

20-abx308446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VN1R5 Polyclonal Antibody

A65978 100 µg
EUR 570.55
Description: The best epigenetics products

VN1R5 siRNA

20-abx939465
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VN1R5 Antibody, HRP conjugated

1-CSB-PA801813LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VN1R5 Antibody, FITC conjugated

1-CSB-PA801813LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VN1R5 Antibody, Biotin conjugated

1-CSB-PA801813LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VN1R5 cloning plasmid

CSB-CL801813HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1074
  • Sequence: atgttgaaattggttattattgagaacatggcagaaattatgctattctcattagatctcttgcttttctccacagatatcctttgctttaattttccttctaagatgatcaaacttcctggttttattaccatacaaatcttcttttatccacaagccagctttggaatttcag
  • Show more
Description: A cloning plasmid for the VN1R5 gene.

VN1R5 Polyclonal Antibody, HRP Conjugated

A65979 100 µg
EUR 570.55
Description: kits suitable for this type of research

VN1R5 Polyclonal Antibody, FITC Conjugated

A65980 100 µg
EUR 570.55
Description: fast delivery possible

VN1R5 Polyclonal Antibody, Biotin Conjugated

A65981 100 µg
EUR 570.55
Description: reagents widely cited

Human VN1R5 shRNA Plasmid

20-abx967189
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VN1R5 Recombinant Protein (Human)

RP044776 100 ug Ask for price

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

VN1R5 ORF Vector (Human) (pORF)

ORF014926 1.0 ug DNA
EUR 354

Polyclonal VN1R5 (aa109-119) Antibody (internal region)

APR13969G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VN1R5 (aa109-119) (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal VN1R5 (aa347-356) Antibody (internal region)

APR13970G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VN1R5 (aa347-356) (internal region). This antibody is tested and proven to work in the following applications:

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

abx030146-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

abx030146-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

20-abx015491
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

20-abx322836
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

abx433448-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

abx433449-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody

20-abx302011
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VN1R5 sgRNA CRISPR Lentivector set (Human)

K2613501 3 x 1.0 ug
EUR 339

VN1R5 sgRNA CRISPR Lentivector (Human) (Target 1)

K2613502 1.0 ug DNA
EUR 154

VN1R5 sgRNA CRISPR Lentivector (Human) (Target 2)

K2613503 1.0 ug DNA
EUR 154

VN1R5 sgRNA CRISPR Lentivector (Human) (Target 3)

K2613504 1.0 ug DNA
EUR 154

VN1R5 Protein Vector (Human) (pPB-C-His)

PV059701 500 ng
EUR 481

VN1R5 Protein Vector (Human) (pPB-N-His)

PV059702 500 ng
EUR 481

VN1R5 Protein Vector (Human) (pPM-C-HA)

PV059703 500 ng
EUR 481

VN1R5 Protein Vector (Human) (pPM-C-His)

PV059704 500 ng
EUR 481

VN1R5 3'UTR GFP Stable Cell Line

TU078141 1.0 ml
EUR 2333

VN1R5 3'UTR Luciferase Stable Cell Line

TU028141 1.0 ml
EUR 2333

Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit

GA-E0006HM-48T 48T
EUR 289

Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit

GA-E0006HM-96T 96T
EUR 466

Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit

QY-E02371 96T
EUR 394

Human Vomeronasal type- 1 receptor 5, VN1R5 ELISA KIT

ELI-51400h 96 Tests
EUR 824

VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2613505 3 x 1.0 ug
EUR 376

VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2613506 1.0 ug DNA
EUR 167

VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2613507 1.0 ug DNA
EUR 167

VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2613508 1.0 ug DNA
EUR 167

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-HAMA Antibody

E61I006 1mg
EUR 349

anti- ASH2L antibody

FNab00637 100µg
EUR 505.25
  • Immunogen: ash2(absent, small, or homeotic)-like(Drosophila)
  • Uniprot ID: Q9UBL3
  • Gene ID: 9070
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against ASH2L

anti- ASIC2 antibody

FNab00638 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 1, neuronal
  • Uniprot ID: Q16515
  • Gene ID: 40
  • Research Area: Neuroscience
Description: Antibody raised against ASIC2

anti- ASIC4 antibody

FNab00639 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: amiloride-sensitive cation channel 4, pituitary
  • Uniprot ID: Q96FT7
  • Gene ID: 55515
  • Research Area: Neuroscience
Description: Antibody raised against ASIC4

anti- ASK1 antibody

FNab00640 100µg
EUR 505.25
  • Recommended dilution: WB: 1:100-1:1000
  • Immunogen: mitogen-activated protein kinase kinase kinase 5
  • Uniprot ID: Q99683
  • Gene ID: 4217
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against ASK1

anti- ASL antibody

FNab00641 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:100-1:500
  • Immunogen: argininosuccinate lyase
  • Uniprot ID: P04424
  • Gene ID: 435
  • Research Area: Metabolism
Description: Antibody raised against ASL
 

Leave a Reply

Your email address will not be published. Required fields are marked *