A reference measurement of circulating ATPase inhibitory issue 1 (IF1) in people by LC-MS/MS: Comparability with standard ELISA
ATPase inhibitory issue 1 (IF1) is a 9.5 kDa protein that binds to mitochondrial and plasma membrane ATP synthase and selectively inhibits ATP hydrolysis. Lately, IF1 was recognized in systemic circulation in people. IF1 appeared as an impartial determinant of HDL-cholesterol with decrease ranges in coronary coronary heart illness (CHD) sufferers. Furthermore, IF1 was additionally discovered to negatively affiliate with mortality in these sufferers, supporting the notion that circulating IF1 could possibly be a promising biomarker of heart problems. Nonetheless, in earlier research, IF1 was quantified by a non-standardized aggressive enzyme-linked immunosorbent assay (ELISA).
- Herein, we’ve validated a liquid chromatography-tandem mass spectrometry methodology (LC-MS/MS) enabling the correct quantification of IF1 in human plasma.
- Plasma IF1 was trypsin-digested by way of an optimized process earlier than LC-MS/MS evaluation. The tactic was efficiently validated over four impartial experiments into the vary of 100-1500 ng/mL. Intra- and inter-assay variation coefficients had by no means exceeded 14.2% and accuracy ranged between 95% and 102% for the chosen EAGGAFGK peptide marker.
- Subsequently, the outcomes of the LC-MS/MS methodology have been in contrast with these obtained utilizing ELISA in 204 people from the GENES research.
- We discovered that IF1 plasma ranges obtained utilizing each strategies have been strongly correlated (r = 0.89, p < 0.0001), whereas the Bland-Altman plot didn’t point out any main statistically important variations. To clinically validate LC-MS/MS, we confirmed the constructive correlation between IF1 plasma ranges and HDL-cholesterol (r = 0.38, p < 0.0001).
- Apart from, we discovered decrease IF1 plasma ranges in CHD sufferers in comparison with controls (431 ± 132 ng/mL and 555 ± 173 ng/mL, respectively; p < 0.0001). Therefore, it may be concluded that the introduced LC-MS/MS analytical methodology offers a extremely particular technique for IF1 quantification in human plasma and could possibly be proposed as a reference methodology.
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349.00 |
Polyclonal VN1R5 Antibody |
APR13971G |
Leading Biology |
0.1ml |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VN1R5 . This antibody is tested and proven to work in the following applications: |
VN1R5 Antibody (HRP) |
20-abx308444 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
VN1R5 Antibody (FITC) |
20-abx308445 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
VN1R5 Antibody (Biotin) |
20-abx308446 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
VN1R5 Polyclonal Antibody |
A65978 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
VN1R5 siRNA |
20-abx939465 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VN1R5 Antibody, HRP conjugated |
1-CSB-PA801813LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
VN1R5 Antibody, FITC conjugated |
1-CSB-PA801813LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
VN1R5 Antibody, Biotin conjugated |
1-CSB-PA801813LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
VN1R5 cloning plasmid |
CSB-CL801813HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1074
- Sequence: atgttgaaattggttattattgagaacatggcagaaattatgctattctcattagatctcttgcttttctccacagatatcctttgctttaattttccttctaagatgatcaaacttcctggttttattaccatacaaatcttcttttatccacaagccagctttggaatttcag
- Show more
|
Description: A cloning plasmid for the VN1R5 gene. |
VN1R5 Polyclonal Antibody, HRP Conjugated |
A65979 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
VN1R5 Polyclonal Antibody, FITC Conjugated |
A65980 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
VN1R5 Polyclonal Antibody, Biotin Conjugated |
A65981 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Human VN1R5 shRNA Plasmid |
20-abx967189 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VN1R5 Recombinant Protein (Human) |
RP044776 |
ABM |
100 ug |
Ask for price |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280.00 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280.00 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280.00 |
VN1R5 ORF Vector (Human) (pORF) |
ORF014926 |
ABM |
1.0 ug DNA |
EUR 354.00 |
Polyclonal VN1R5 (aa109-119) Antibody (internal region) |
APR13969G |
Leading Biology |
0.1 mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VN1R5 (aa109-119) (internal region). This antibody is tested and proven to work in the following applications: |
Polyclonal VN1R5 (aa347-356) Antibody (internal region) |
APR13970G |
Leading Biology |
0.1 mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VN1R5 (aa347-356) (internal region). This antibody is tested and proven to work in the following applications: |
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
20-abx015491 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
|
- Shipped within 5-10 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
abx030146-400ul |
Abbexa |
400 ul |
EUR 523.00 |
- Shipped within 5-10 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
abx030146-80l |
Abbexa |
80 µl |
EUR 286.00 |
- Shipped within 5-10 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
20-abx322836 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
abx433448-200ul |
Abbexa |
200 ul |
EUR 286.00 |
- Shipped within 1-3 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
abx433449-200ul |
Abbexa |
200 ul |
EUR 286.00 |
- Shipped within 1-3 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
20-abx302011 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
VN1R5 sgRNA CRISPR Lentivector set (Human) |
K2613501 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
VN1R5 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2613502 |
ABM |
1.0 ug DNA |
EUR 154.00 |
VN1R5 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2613503 |
ABM |
1.0 ug DNA |
EUR 154.00 |
VN1R5 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2613504 |
ABM |
1.0 ug DNA |
EUR 154.00 |
VN1R5 Protein Vector (Human) (pPB-C-His) |
PV059701 |
ABM |
500 ng |
EUR 481.00 |
VN1R5 Protein Vector (Human) (pPB-N-His) |
PV059702 |
ABM |
500 ng |
EUR 481.00 |
VN1R5 Protein Vector (Human) (pPM-C-HA) |
PV059703 |
ABM |
500 ng |
EUR 481.00 |
VN1R5 Protein Vector (Human) (pPM-C-His) |
PV059704 |
ABM |
500 ng |
EUR 481.00 |
VN1R5 3'UTR GFP Stable Cell Line |
TU078141 |
ABM |
1.0 ml |
EUR 2333.00 |
VN1R5 3'UTR Luciferase Stable Cell Line |
TU028141 |
ABM |
1.0 ml |
EUR 2333.00 |
Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit |
GA-E0006HM-48T |
GenAsia Biotech |
48T |
EUR 289.00 |
Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit |
GA-E0006HM-96T |
GenAsia Biotech |
96T |
EUR 466.00 |
Human Vomeronasal type- 1 receptor 5, VN1R5 ELISA KIT |
ELI-51400h |
Lifescience Market |
96 Tests |
EUR 824.00 |
VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K2613505 |
ABM |
3 x 1.0 ug |
EUR 376.00 |
VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K2613506 |
ABM |
1.0 ug DNA |
EUR 167.00 |
VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K2613507 |
ABM |
1.0 ug DNA |
EUR 167.00 |
VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K2613508 |
ABM |
1.0 ug DNA |
EUR 167.00 |
Anti-Anti-SEPT6 antibody antibody |
STJ11100949 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined. |
Anti-Anti-SEPT9 Antibody antibody |
STJ111369 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-Anti-SEPT4 Antibody antibody |
STJ112276 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. |
Anti-Anti-SEPT5 Antibody antibody |
STJ25477 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. |
Anti-Anti-SEPT8 Antibody antibody |
STJ25479 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT7 Antibody antibody |
STJ28963 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. |
Anti-Anti-SEPT5 Antibody antibody |
STJ114819 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. |
Anti-Anti-SEPT7 Antibody antibody |
STJ116214 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. |
Anti-Anti-SEPT8 Antibody antibody |
STJ117206 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT12 Antibody antibody |
STJ117759 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT1 antibody antibody |
STJ119580 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012] |
Anti-Anti-DDB1 Antibody |
A00333 |
BosterBio |
100uL |
EUR 455.00 |
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
AEA465Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5647.80 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
AEA465Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 552.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
AEA465Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 746.80 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
AEA465Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3060.60 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
4-AEA465Hu |
Cloud-Clone |
-
EUR 5698.00
-
EUR 3011.00
-
EUR 747.00
|
|
- Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
- Sperm Antibodies
- Antisperm Antibodies
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody) |
ELK8071 |
ELK Biotech |
1 plate of 96 wells |
EUR 432.00 |
- The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Anti-CYFIP2 Antibody |
A06562 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat. |
Anti-GPS2 Antibody |
A06569 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat. |
Anti-PRKX Antibody |
A06585-1 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
Anti-PPA2 Antibody |
A06587 |
BosterBio |
100ug/vial |
EUR 294.00 |
Anti-GluR8 Antibody |
A06589 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
Anti-EDG7 Antibody |
A06597-1 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |
Detection of latent types of Mycobacterium avium subsp. paratuberculosis an infection utilizing host biomarker-based ELISAs significantly improves paratuberculosis diagnostic sensitivity
Bovine paratuberculosis (PTB) is a power granulomatous enteritis, brought on by Mycobacterium avium subsp. paratuberculosis (MAP), accountable for necessary financial losses within the dairy trade. Present diagnostic strategies have low sensitivities for detection of latent types of MAP an infection, outlined by focal granulomatous lesions and scarce humoral response or MAP presence. In distinction, patent infections correspond to multifocal and diffuse sorts of enteritis the place there’s elevated antibody manufacturing, and substantial mycobacterial load.
Our earlier RNA-Seq evaluation allowed the number of 5 candidate biomarkers overexpressed in peripheral blood of MAP contaminated Holstein cows with focal (ABCA13 and MMP8) and diffuse (FAM84A, SPARC and DES) lesions vs. management animals with no detectable PTB-associated lesions in gut and regional lymph nodes. The goal of the present research was to evaluate the PTB diagnostic potential of business ELISAs designed for the particular detection of those biomarkers.
The flexibility of those ELISAs to establish animals with latent and/or patent types of MAP an infection was investigated utilizing serum from naturally contaminated cattle (n = 88) and non-infected management animals (n = 67). ROC evaluation revealed that the ABCA13-based ELISA confirmed the very best diagnostic accuracy for the detection of contaminated animals with focal lesions (AUC 0.837, sensitivity 79.25% and specificity 88.06%) and with any kind of histological lesion (AUC 0.793, sensitivity 69.41% and specificity 86.57%) enhancing on the diagnostic efficiency of the favored IDEXX ELISA and different standard diagnostic strategies.
SPARC and MMP8 confirmed the very best diagnostic accuracy for the detection of animals with multifocal (AUC 0.852) and diffuse lesions (AUC 0.831), respectively. In conclusion, our outcomes recommend that quantification of ABCA13, SPARC and MMP8 by ELISA has the potential for implementation as a diagnostic software to reliably establish MAP an infection, significantly enhancing early detection of MAP latent infections when antibody responses and fecal shedding are undetectable utilizing standard diagnostic strategies.
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349.00 |
Polyclonal VN1R5 Antibody |
APR13971G |
Leading Biology |
0.1ml |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VN1R5 . This antibody is tested and proven to work in the following applications: |
VN1R5 Antibody (HRP) |
20-abx308444 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
VN1R5 Antibody (FITC) |
20-abx308445 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
VN1R5 Antibody (Biotin) |
20-abx308446 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
VN1R5 Polyclonal Antibody |
A65978 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
VN1R5 siRNA |
20-abx939465 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VN1R5 Antibody, HRP conjugated |
1-CSB-PA801813LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
VN1R5 Antibody, FITC conjugated |
1-CSB-PA801813LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
VN1R5 Antibody, Biotin conjugated |
1-CSB-PA801813LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against VN1R5. Recognizes VN1R5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
VN1R5 cloning plasmid |
CSB-CL801813HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1074
- Sequence: atgttgaaattggttattattgagaacatggcagaaattatgctattctcattagatctcttgcttttctccacagatatcctttgctttaattttccttctaagatgatcaaacttcctggttttattaccatacaaatcttcttttatccacaagccagctttggaatttcag
- Show more
|
Description: A cloning plasmid for the VN1R5 gene. |
VN1R5 Polyclonal Antibody, HRP Conjugated |
A65979 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
VN1R5 Polyclonal Antibody, FITC Conjugated |
A65980 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
VN1R5 Polyclonal Antibody, Biotin Conjugated |
A65981 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Human VN1R5 shRNA Plasmid |
20-abx967189 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VN1R5 Recombinant Protein (Human) |
RP044776 |
ABM |
100 ug |
Ask for price |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280.00 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280.00 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280.00 |
VN1R5 ORF Vector (Human) (pORF) |
ORF014926 |
ABM |
1.0 ug DNA |
EUR 354.00 |
Polyclonal VN1R5 (aa109-119) Antibody (internal region) |
APR13969G |
Leading Biology |
0.1 mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VN1R5 (aa109-119) (internal region). This antibody is tested and proven to work in the following applications: |
Polyclonal VN1R5 (aa347-356) Antibody (internal region) |
APR13970G |
Leading Biology |
0.1 mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VN1R5 (aa347-356) (internal region). This antibody is tested and proven to work in the following applications: |
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
20-abx015491 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
|
- Shipped within 5-10 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
abx030146-400ul |
Abbexa |
400 ul |
EUR 523.00 |
- Shipped within 5-10 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
abx030146-80l |
Abbexa |
80 µl |
EUR 286.00 |
- Shipped within 5-10 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
20-abx322836 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
abx433448-200ul |
Abbexa |
200 ul |
EUR 286.00 |
- Shipped within 1-3 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
abx433449-200ul |
Abbexa |
200 ul |
EUR 286.00 |
- Shipped within 1-3 working days.
|
Vomeronasal 1 Receptor 5 (gene/pseudogene) (VN1R5) Antibody |
20-abx302011 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
VN1R5 sgRNA CRISPR Lentivector set (Human) |
K2613501 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
VN1R5 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2613502 |
ABM |
1.0 ug DNA |
EUR 154.00 |
VN1R5 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2613503 |
ABM |
1.0 ug DNA |
EUR 154.00 |
VN1R5 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2613504 |
ABM |
1.0 ug DNA |
EUR 154.00 |
VN1R5 Protein Vector (Human) (pPB-C-His) |
PV059701 |
ABM |
500 ng |
EUR 481.00 |
VN1R5 Protein Vector (Human) (pPB-N-His) |
PV059702 |
ABM |
500 ng |
EUR 481.00 |
VN1R5 Protein Vector (Human) (pPM-C-HA) |
PV059703 |
ABM |
500 ng |
EUR 481.00 |
VN1R5 Protein Vector (Human) (pPM-C-His) |
PV059704 |
ABM |
500 ng |
EUR 481.00 |
VN1R5 3'UTR GFP Stable Cell Line |
TU078141 |
ABM |
1.0 ml |
EUR 2333.00 |
VN1R5 3'UTR Luciferase Stable Cell Line |
TU028141 |
ABM |
1.0 ml |
EUR 2333.00 |
Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit |
GA-E0006HM-48T |
GenAsia Biotech |
48T |
EUR 289.00 |
Human Vomeronasal 1 Receptor 5(VN1R5)ELISA Kit |
GA-E0006HM-96T |
GenAsia Biotech |
96T |
EUR 466.00 |
Human Vomeronasal type- 1 receptor 5, VN1R5 ELISA KIT |
ELI-51400h |
Lifescience Market |
96 Tests |
EUR 824.00 |
VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K2613505 |
ABM |
3 x 1.0 ug |
EUR 376.00 |
VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K2613506 |
ABM |
1.0 ug DNA |
EUR 167.00 |
VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K2613507 |
ABM |
1.0 ug DNA |
EUR 167.00 |
VN1R5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K2613508 |
ABM |
1.0 ug DNA |
EUR 167.00 |
Anti-Anti-SEPT6 antibody antibody |
STJ11100949 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined. |
Anti-Anti-SEPT9 Antibody antibody |
STJ111369 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-Anti-SEPT4 Antibody antibody |
STJ112276 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. |
Anti-Anti-SEPT5 Antibody antibody |
STJ25477 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. |
Anti-Anti-SEPT8 Antibody antibody |
STJ25479 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT7 Antibody antibody |
STJ28963 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. |
Anti-Anti-SEPT5 Antibody antibody |
STJ114819 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. |
Anti-Anti-SEPT7 Antibody antibody |
STJ116214 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. |
Anti-Anti-SEPT8 Antibody antibody |
STJ117206 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT12 Antibody antibody |
STJ117759 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-Anti-SEPT1 antibody antibody |
STJ119580 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012] |
Anti-Anti-DDB1 Antibody |
A00333 |
BosterBio |
100uL |
EUR 455.00 |
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
AEA465Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5647.80 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
AEA465Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 552.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
AEA465Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 746.80 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
AEA465Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3060.60 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Int
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids. |
Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit |
4-AEA465Hu |
Cloud-Clone |
-
EUR 5698.00
-
EUR 3011.00
-
EUR 747.00
|
|
- Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
- Sperm Antibodies
- Antisperm Antibodies
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody) |
ELK8071 |
ELK Biotech |
1 plate of 96 wells |
EUR 432.00 |
- The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Anti-CYFIP2 Antibody |
A06562 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat. |
Anti-GPS2 Antibody |
A06569 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat. |
Anti-PRKX Antibody |
A06585-1 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
Anti-PPA2 Antibody |
A06587 |
BosterBio |
100ug/vial |
EUR 294.00 |
Anti-GluR8 Antibody |
A06589 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
Anti-EDG7 Antibody |
A06597-1 |
BosterBio |
100ul |
EUR 397.00 |
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat. |